As sequence input data PHYLLAB accepts two formats: 1. Multyple fasta format. The name of every sequence started by the '>' symbol in the first position. If line don't starts with the '>' it assumes to be a sequence data. Sequences and names go's together. Non-letter symbols (besides gap symbol: '-') are ignored. Recomended extention "FA". Example: >sequence 1 ATGATCATCQAGCATCACTCTACGACA TGTGCTGCTCTATGCTGCTGCTGCATGCTGCTCTGCTGCTCTG >Sequence 2 ATGCTGTTTTTCCTCGTG C T GCTGCTGCTGCTGCT G C TG C TGC TGC T C--- CTGTCTGTGTCGC >Sequence 3 ATAGAGTAT Only '-' is allowed as a symbol for deletion. 2. Set file format. A file should posses extension "SET". The first line is the comment line up to 75 characters long. The second line should contain two decimal numbers (the number of sequences and the normalized length After go's sequence names (each on a line). After all sequence names go's the sequences in the same order as names. The length of every sequence shoulbe exactly the same as declared in the second line - the gap symbols appends to the end of short sequences. Example: Test set 3, 20, Sequence 1 Sequence 2 Sequence 3 ATGCGTCGTTATGCGTCGTT ATG--TCG-TATGCGTCGTT ATGCGTCGTTATGCG-----
Tree formats. PHYLLAB uses binary-tree input in a 'parentheses'-encoding format (introduced by Arthur Cayley in 1857) that is similar to the popular Newick format (http://evolution.genetics.washington.edu/phylip/newicktree.html ). For example the tree /\ / \ / \ \ /\ \ \ / \ \ \ 1 2 3 4 should be in represented in 'parentheses' format like this (((1,2),3),4) The 'parenthesis' representation is not a unique, for example the above tree can be also represented as (4,((1,2),3)) or (4,(3,(1,2))) or (4,((2,1),3)) or ... in order to get a standard representation use the unitree - function of PHYLLAB. Data files included as an example: vk.brn vk.tre